-----------
Mon 30dec13
- Vic - problems loading marker synonyms, last item does not load. Fixed
* synonymize/rename existing tags during data load (length at least 60; no
reverse complement for now)
- T3 collaboration with students, our interactions with industry,
international collaborations, and other international projects.
**** Send JL PAG Workshop projects, and BDB
- Clay - new heatmap R package used for plot level data installed
- David M - tool to add breeding programs
- done. Now need one to add Institutions.
- review T3 posters for PAG. PhenomApp. Tablet Tools typos.
- Clay - you can now load CSR index calculation as a plot level trait then
calculate line means. We should think about how we want to handle
measurements at multiple time intervals, naming CSR traits, and customized
indices.
? How to find CSR data in T3 now?
- Shichen, Eduard re .vcf data
- Naming hwwampGBS tags as synopGBS where matching
****- add Selection Index to Analyze menu?
- Golden Helix software webinar
- drop SNPs with too-high LD
- Color by line properties like breeding program, market class
- done: rounding phenotype values in phenotype/show.php
- "Curate Anything" direct table editor too dangerous
- merging things vs. renaming
- problem if phenotype file has an empty column
****- send JL WhatsNew features and data for TCAP report
-----------
Mon 16dec13
****- rounding phenotype values in phenotype/show.php
****- checkline > 1 causes all phenotype data to be ignored
- marker allele (Genetic Character) data from Gina, Guihua, Deven
- GMOD meeting after PAG
****- add old agenda items to this file
****- Guttieri allele conflicts. Queries for quality of lines, expts. See
Golden Helix software. Rename her 12 lines from 90K expt?
****- omit Genetic Characters from Barley "Data Submission"
V,C- hwwampGBS tags named as synop where matching
- next meetings 30dec, 6jan
J- Shichen, Eduard re vcf
-----------
Mon 9dec13
- semantic web (SSWAP) demo by iPlant on integrating data
- select marker page - can this have a link like "show line information"
- compare trials page - added a new display format (trait vs trial)
- cluster 3D pages - added email notification for large data sets
- email from tcap machine - setting up email relay/proxy to prevent mail
being identified as SPAM
- ordering and setup of T3 mirror computer
- PAG workshops
-----------
Mon 25nov13
- User group conference call on Dec 2, work on agenda
- PAG abstracts/workshops - any speakers for phenotyping databases workshop?
- systems - no hardware errors on tcap machine since Nov 19th, progress on
email relay?
- GBS data loaded on production machine - the download page is not working
correctly, on most downloads the default settings for filtering leave no
results even though it is working okay on malt machine. There could be
something wrong with the way missing data is handled.
- compare trials - tutorial
-----------
Mon 18nov13
- GBS data - consensus phase errors, VCF file from Shichen Wang
- Marker panels now available on "select markers" page. EurekaPanel is
loaded with mouse over description on barley. Download link to retrieve
marker sequence (I need to add the link to a few other parts of the code).
- systems - memory errors, email, mirror machine
- PAG posters / workshop
- User group conference call on Dec 2
-----------
Tue 12nov13
- GBS data from Eduard?
- WheatIS (Wheat Information System) EWG (expert working group)
- Consensus map - After removing a few markers that where have non standard
chromosome (3D2, 3D3, 5D1cult, 5D2cult, 5D3cult) the import was successful.
Total of 24,535 markers mapped. Article on LPmerge is submitted by Jeff
Endleman but has not been published yet.
- Select Marker Page - Currently selected markers are not shown if you have
over 1000 selected because the page would take too long to load. There is
now an option to download the list when you have over 1000 selected.
- Tcap machine - There are still regular hardware errors in the message logs.
Progress on email proxy?
- Next User Group conference call on Dec 2. Agenda items?
- PAG - Managing Crop Phenotype Data?
-----------
Mon 4nov13
- User Group conference call on Veterans Day? Monday Dec 2.
- email problems on malt and tcap, no Reverse DNS
- PAG posters, talks, workshop
- GBS data from Eduard
- Tablet interface now live. Problem with non-Serpentine/Zigzag plot
numbering
- consensus map for wheat from LPmerge.R
- new projects:
- creating experimental designs
- parsing vcf files
- user defined marker sets
- meeting Tue 12nov instead of 11nov
-----------
Mon 28oct13
- Android Field Book app - see prototype on
http://malt.pw.usda.gov/cbirkett/t3/wheat , under curate menu select
"Tablet Tools"
D- email problems from T3 website with Univ of Minnesota
- non USDA mirror of T3 website
- GBS - conference call with Eduard at 3pm
- PAG - posters and presentations
- next User Group meeting
- Programing language for Vic? What would be most useful?
- Features to discuss on update of T3 description for Crop Science.
C- wider Trial selection box for longer names
- PAG workshop on Phenotype Data
Eduard:
vcf format, names of contigs from IWGSC
missing the intergenic tags
missing tags unique to one line
tags-by-taxa contains more info
Baenziger HWW data is currently reference-genome-bases.
Ref seq to be submitted for publication in 3-4 weeks
bar-file alignment file exists for HWW
samtools to convert to vcf
names based on contig/position
CSS2
HWW data manuscript in prep, another month
-----------
Mon 21oct13
- GMOD in a Box for private data, vs. iPlant, Amazon cloud etc
- PAG poster and talks, deadline Nov 1
* - Clay, Vic posters, *Dave Demo
* - Workshop: Jeremy Edwards Cassavabase, GDR
- tcap machine RAM failure being fixed
- project updates
*** - GBS: meeting with Eduard? Oct 28. marker names?
- android tablet interface
- GBS imputation: keep separate from raw? by Experiment?
separate allele_cache table? User selection box Raw/Imputed in QuickLinks
"% imputed" as a marker filter.
Use map info for imputation if available, then use map-free method GLMNet.
Use quantitative allele scores instead of integer?
Impute by Platform instead of by Experiment?
- MySQL "read replica" for loading big genotyping datasets?
- separate Line files for each breeding program.
- user group meeting: Nov 4
- Endelman's LPMerge.R for consensus maps
-----------
Mon 30sep13
- User Group meeting to follow
- GBS marker naming (Vic's memo)
- calculating kinship matrix from pedigree info
- NCBI vs. GBS
- Imputation on agenda every week
- SAB inputs re GBS markers (Robbie etc.)
- ca. Oct14 for a meeting with Jesse and Eduard
-----------
Mon 23sep13
C- imputing GBS alleles from pedigree, Ibrahim
P- imputation pipeline in T3, using TASSEL?
- short names for GBS markers: Document!
- marker duplicates/synonyms from BLAST, VLookUp
* - synopGBS115859_A; tplb, IACX, TA
- select markers by platform
- plot-level -> line means
- heatmap for plot-level data
- Compare Trials
- tablet experiment design and data import
*- Eduard re GBS data
V- AB to ATCG for SynOp Antmap vs. Binmap - discrepancies
- User Group meeting next week
- plot-level > line means, heatmap, Compare Trials, tablet, priority survey
-----------
Mon 9sep13
- naming of GBS markers serial numbers (synopGBS123912) or long string
- select markers by platform
GBS_restriction_site
GBS_sequence_capture
Infinium
GoldenGate
Sequenome
- do we need page to display markers/platforms for selected lines?
- GBS data from Edward, do we need more access restrictions to publish this
data before journal publication
- plot level data from Tom and Ken - CAP_Analysis_Showdown, adjusting plot data
- *future projects*
users can download randomized field layout files from T3
tablet-based data collection apps
methods to analyze these plot/mean data jointly to improve prediction power
- *current projects*
1. marker selection
2. identify
markers with identical sequence (BLAST)
3. genotype experiment annotation import (add platform)
-----------
Tue 3sep13
- merging/deleting lines
?? Delete
a line's data from a Trial?
- Eduard's info re GBS
- ugly message when trying to view a User record, e.g. Clara
*?? Unrestrict?
- better handling of missing data in Cluster by Genotype
- better downloading of CSR data
****- download allele conflicts; restrict to currently selected lines
- GBS HWW AM panel data from Baenziger and Haley
- GBS canonical name vs. synonym
SynOp Antmap is canonical, Binmap synonym
OWB GBS not in production
?? Name GBS markers as per
"TGCAGAAAAAAAAA[C/T]TTAACTGAGTTGTACCCCATAGCCGAGATCGGAAGAGCGGTTCAGCAGG" ?
- Workstudy students
- 90K wheat HW AMPanel line naming being corrected by Eduard
-----------
Mon 26aug13
- genotyping Platforms can now be created and modified
- what platforms to create?
VeraCode, Infinium (9K, 90K), GoldenGate; Sequenom; KASP;
Restriction-site GBS, Exome-capture GBS
V- GBS HWW AM panel data from Baenziger and Haley
- Work-Study applicants; what projects?
***- Jesse and Eduard re matching GBS markers between experiments
Questions:
Are there ever two SNPs within a tag?
Range of tag lengths?
Exome-capture:
Can the direction (strand) of a sequence ever swap?
NNN punctuation between genes? Alignment across a junction?
Answers:
1. Matching: Construct all four haplotypes within a run and
look for perfect matches.
2. Spring wheat NAM parents (70) being resequenced by exome capture
(releasable by end of year). Also 200 barleys. This fall will have
seeds of 200 populations, -> 90K, then GBS by restriction-site using
parental SNPs to impute. (Exome-capture too expensive.)
3. Now using IWGSC single-chromosome WGS sequence as reference. (Repeats
tend to get excluded by assembler.) Estimate of the coordinate system
lifetime 2-3 years.
4. Host it? VCF file format (see Gramene). Look at it privately starting
in September, release end of year.
5. Can give T3 Duster x Billings, and a Montana mapping population.
6. 50% overlap using SAME SynOp dataset, just different pipelines.
7. Now using GBS for QTL mapping in F2 populations.
- T3 annual report for TCAP
- SNOWMASS, CO03W054, CO03W054-2, and Mary Guttieri
* - deleting a line (with data) vs. merging two lines
-----------
Tue 20aug13
- improvements in selecting maps
- improvements in handling lines with missing allele data
- missing email notifications from genotype data loading
- Genotyping experiments now have marker types.
- What marker types do we want?
GBS SNP, Illumina Chip Array SNP, (Targeted GBS SNP), DArT
- Platforms:
VeraCode, Infinium (9K, 90K), GoldenGate; Sequenom
GBS: Exome-capture, Restriction-site
KASP
hierarchy with Platform/MarkerType/Subplatform?
* remove Type from Markers, move to Genotype Experiment
** add Platform to Genotype Experiment, as a table of specific names
- 8-bit characters, ASCII > 127, now being removed from line names
- CropScan CSR instrument's parameters now supported
- GBS data: tags-by-taxa file as Raw Data?
****- WhatsNew "Gentic"
* Select Mapped Markers !!
-----------
Mon 12aug13
- report from Executive Committee meeting
- cleaning up marker_types
-
selecting markers by type, platform, experiment
http://malt.pw.usda.gov/cbirkett/t3/barley/marker_type_select.php
http://malt.pw.usda.gov/t3/barleytest/genotyping/marker_selection.php
***@ Add genotype_experiment_info.marker_type_uid; copy from markers in each;
Display in report display_genotype.php.
- hierarchy of categories for genotyping expts.
- *,notV: define marker_types to assign to genotype_experiment_info.marker_type_uid
- SNOWMASS, CO03054, CO03054-2 back in the news
*- deleting/merging lines that have data
"update phenotype_data set line_record_uid=X where line_record_uid=Y"
- allow user to select genotyping experiments to use for Download etc.?
- comparing maps against each other, for Tom
http://triticeaetoolbox.org/barley/maps/compare_maps.php
- updating What's New
- comparing GBS pipelines
*- synonymizing: who should do it? how? Ask Eduard/Jesse.
- loading CSR files from CropScan instrument
- Line report now excludes other folks' private panels.
**** Running for barley too?
- JL here Tue-Fri next week.
*Arrange meeting with Jesse/Edward Wed(?)
-----------
Mon 5aug13
- many SCRI markers missing from Download genetic maps
- Should the genetic map from Download include only markers that are
genotyped for the selected lines?
- GBrowse still not installed on tcap
- Marker report now shows map locations of the marker
- Download now requires less memory
- malt upgraded to 64 GB RAM
- spaces in filenames now refused (.zip? CSR? from users' sandbox?)
- GBS discussion with Jesse and Eduard
*- different GBS runs for mapping vs. panels; which strand?
J**? re loading GBS SNPs A/B-called using parental allele
- SNP tag-matching at Marker upload time
- Tassel GBS Pipeline now "complete"
- Scientific Advisory Board meeting Aug 8: What's New since PAG?
*Vic, Clay, Dave by Wednesday
- Integrated Breeding Workflow System installed on Dave's PC
https://www.integratedbreeding.net/breeding-activities
- Tom: select multiple maps?
- consensus wheat map from the PNAS (110:8057, Cavanaugh et al)
- tutorial movies, http://www.youtube.com/TheTriticeaeToolbox
"SelectLines, Lesson One"
- meeting with Jamie Sherman on Aug 12 to discuss the class next fall
- use wildcards in the Select Markers by Name box
- Wizard 'Select trials with all lines'
*** select Markers by platform (DArT etc). Legitimacy. Select by Genotype
Experiment; remove Select Markers by GBrowse
-----------
Mon 29jul13
* Marker links to Barley Physical Map,
http://malt.pw.usda.gov/t3/barley/view.php?table=markers&name=11_10815
- Marker links to Tim's Barley BACs v2,
http://harvest-web.org/utilmenu.wc?job=RTRVFORM&db=MOREX_HV3_10
* http://harvest-web.org/utilmenu.wc?job=RTRV_TCAP&UCRFPC=Y&MARKER=1_0256
- Annotations "Dataset Description" on the Marker report page,
http://malt.pw.usda.gov/t3/barley/view.php?table=markers&name=3_0015
- Yong-Bi Fu's problems downloading 90K data for 2000 lines
- CSR annotation in single file per field, with multiple trials/dates/channels?
Or all from a single date?
* proposal
- wheat 90K marker names, IWB
- SNP allele AB to ATCG translation
- 10012-1239 (11_20002) is TOP [A/G] in GoldenGate, BOT [T/C] in Infinium.
- Remove all marker annotations U32_*.
* new GG Locus Remark type for Morrell data
Description "
Grantham Score: 110
SNP Codon 2: AGC"
-----------
Mon 22jul13
- Line report page now links to the panels it's in.
http://triticeaetoolbox.org/barley/view.php?table=line_records&name=robust
- Content Status page now links to CSR experiments.
- PAG "Crop Phenotype Data" workshop again, Saturday 10:30am?
* invite folks. Hi-thruput phenotyping (Jesse, Mike Gore), API, interface,
schema/structure, variant "traits" by protocol, date (problems with
integrating, interface); plot-level
- Place on T3 to acknowledge good citizens. Karen Beaubien. Celeste's
suggestion. Araby Belcher
- agenda once/month.
- Silly Award announcements at PAG next year for contributions. T-Karma.
Deputy Curator. Falconizer.
- Vic: 'A large amount of genotype data for was just released...'
- DArT data from GRIN. LTT from Pat Hayes
- *move generalized line properties to barley
- OWB SNP-type annotations from Peter Morrell
http://malt.pw.usda.gov/t3/barley/view.php?table=markers&uid=4031
- *SNP allele AB to ATCG translation
- Tim Close visits Cornell this week.
- BLAST results on genome map (karyotype graphic)
- iPlant as an offsite backup of our data
- importing plot-level phenotype data; validating fieldbook contents
- CSR annotation in single file per field, with multiple trials/dates/channels?
-----------
Mon 15jul13
- Wizard -> Lines now offers Trials with ALL or ANY of the lines
- Stress Indices: Analyze -> Compare Trials
**** invite Celeste
- ***List the panels that a line is included in on its Line Record page?
? including user's private panels?
- line name woes in Spring AM panel
- new barley maps from Maria / Jeffrey
- Tassel V3 and V4 download formats combined
- "Barley, 2012 SNP, JHutton" map description corrected
- Allele Conflicts when loading genotype data now uses Clay's faster method.
* Download button for conflicts
- combining CSR files for upload?
- Scientific Advisory Board meeting Aug 8: What's New?
- plot-level data calculations
- iPlant instance?
- Gina re Shiaoman vs. Akhunov, 90K HWW Baenziger
- trait "Canopy Spectral Reflectance"? Download menu?
-----------
Mon 8jul13
- *Allele Conflicts: Clay proves 100,000 queries are better than one.
- QuickSearch lock-up is due to "SHOW CREATE TABLE ac_temp" while running
"CREATE TABLE ac_temp (select * from allele_view)". !!
* - "create TEMPORARY table"
- disk and memory orders for malt
- To Discuss: synonymizing GBS markers.
J- Make a plan.
- loading Line Properties fixed; new Line Submission template
- Selection Index now uses normalized trait scores,
http://malt.pw.usda.gov/t3/bd/Index/traits.php
* percent of common line(s)
- JL Trial Means still in process until done
(plot-level R function to compute the trial mean)
- missing Line Panels Tutorial files fixed
- new CSR data from Araby, Oregon State
-----------
Mon 1jul13
- tcap lockup when loading allele data
- increase memory allocation, caching?
- reserved characters in URLs: ! * ' ( ) ; : @ & = + $ , / ? # [ ]
* - use urlencode() from Show Line Info
****- Nebraska DArT markers from Ibrahim
- delete all old GBS markers and reload?
- missing properties for Cornell lines, AMERICAN_BANNER etc
***- new template needed
***- warning on unrecognized properties
- Selection Index underway, http://malt.pw.usda.gov/t3/bd/Index/traits.php
*- "Reverse"
scale
****- disk and memory orders for malt
- CAP Data Programs now shows program type
- "Select these lines" for a genotype experiment,
http://triticeaetoolbox.org/wheat/display_genotype.php?trial_code=TCAP90K_NAMparents_panel
-
Stress Index, http://malt.pw.usda.gov/t3/barley/analyze/compare_index.php
- GBS markers (Vic)
- job opening for data curator,
https://cornellu.taleo.net/careersection/10161/jobdetail.ftl?job=352929
(Cassavabase clone, GBS data)
*- Allele Conflicts updated. Needs a Download button.
- Eduard's 90K panel, 2000 lines, lousy line names
- Eduard's 90K re-clustering of AM panels
!- To Discuss: synonymizing GBS markers
-----------
Mon 24jun13
- multiple CSR files per day, with different weather
- Stress Index examples from Celeste
* - wait for Selection Index page from Dave
- DArT marker alleles now displayed as 1 or 0
genotyping/show.php: Header for "Line:"
- DArT allele data from Nebraska
- malt out of disk space for MySQL temporary table when querying for
allele conflicts
****- trouble with loading large phenotype trials (Tom).
- Toronto Statement page, http://triticeaetoolbox.org/wheat/toronto.php
- 1-time popup still needed
- commas and ampersands in line names okay most places;
* problem in Cluster by Genotype
- Quick Search modified for better multiword searches
- Tom is interested in giving us both plot level data and data adjusted for
the augmented design to compare for the 2012 agronomic data for the CAPWUE
trials in Bozeman and Huntley.
- Dataset delivery updated, 'friendly reminders' going out this morning.
- new template for fieldbook import, allowing multiple trials
- version numbering of templates: header vs. script's internal value
- Kevin's public, citable line-panels
****- get lines by genotype trial; link from report for the experiment
****- all_breed_css.php should show Program Type;
*- validate that genotyping annotation must refer to a *genotyping* program
**** - RAM for malt; status??
-----------
Mon 17jun13
- Celeste: calculating stress indices (GxE indices?), #2494
geometric mean, (normal)**-1/2 vs. treated
divided by mean of whole normal trial (all lines), squared
"Stress Tolerance Index"
More than two trials? Maybe multiple levels of treatment.
Calculate for each environment separately.
Exporting result as a "Trait": Pass it as a session variable? Save as file?
- nonintuiveness feedback from Brian Bowman, #2478
**** special-case <space> in PI numbers in Quick Search, Lines by Properties
- nonintuiveness feedback from Mark Sorrells
- report of Friday's Executive Committee meeting
- Growth Stage Ontology homework. Zadoks, Gramene...?
V** - Toronto Agreement, terms of use
- delinquent datasets
- CSR data from Bozeman and Davis
- Show Line Info now uses generalized Properties, includes GRIN
**** - yikes! Barley is broken!
- Select by Properties now uses generalized Properties (wheat only)
- ampersand and comma in line names
- malt RAM increase? 16 GB -> 64 GB, $1000
- DArT markers and alleles loadable
- Plot-level results input format now allows multiple trials.
- Field book, CSR results...
-----------
Mon 10jun13
- Vic's report from NAPB Tampa
- Dubai data demo
- iPlant
wants to collaborate
- T3 virtual machines; data persistence?
- more processors
- 10-lesson T3 course for PBTN next Fall
- Offline GWAS calculation with email notification. E.g. command-line Tassel
- making private line panels public (Kevin Smith)
- citable datasets/URLs for use in publications; trials, linepanels, traits
*- Illumina and GBS SNPs on barley physical map from Zaragoza
- API to fetch locations from GrainGenes?
- including GRIN accession in Show Line Info
- Trait "CSR Data"
- loading DArT markers
- plot level measurements
- T3 pedigree issue
- updating Allele Conflicts
-----------
Mon 3jun13
- Toronto Agreement data terms-of-use, see Cassavabase
* add homepage notice and Data Submission description of what to add.
- format for DArT markers.
- use Nebraska's.
* Document when uploading.
C Revise scripts for input and export. Diversity Arrays uses 1,0,-.
- plot-level vs. trial-mean data loading and replacing
- warn if uploading trial means file and trial mean already exists
- one flag for each trial telling whether user-calculated or T3. Version.
C/J - calculating trial mean data from plot-level data
not Arithmetic mean. Least-square means = fixed-effects model = BLUEs.
mixed-model. deregressed BLUPs. Input requires field layout of plots v.
lines
E - growth stage as a Trait; Feekes, Zadoks, Haun or Gramene?
* - exporting line synonyms/GRIN-accessions more easily. Ask Tom.
- allele data conflicts
- out-of-memory error loading results from a small trial
- hclust problem with small datasets
- Sandbox refreshing problem due to overlapping cron jobs. Fixed
**** - more room for WhatsNew. Too much new data!
* - Bockelman: CV vs. PI links ever different?
- permissions on files in directory raw/phenotype/
-----------
Tue 28may13
- API for T3?
?- wheat Sandbox not refreshing; time required? Do it less often?
- Baenziger 90K vs. 9K kinship discrepancies
- ASD Handheld 2 instrument description
- CSR date vs. growth stage of each plot or line
? - add another header row to CSR results file?
- identifying plots that have outlier CSR index values
- CSR smoothing procedure, R runmed()
- Tassel link for small-memory Tassel?
- multi-trait "selection indices" promised to Breeders Database by July 1
* - different scales: "standardize" by subtracting mean & dividing by SD
* - correlate index vs each trait
- bug in deleting trials fixed
- blast/blast.php unused?
****- Jim Kolmer's pathology scores; Bowden translator
*- check Allele Data Conflicts
- "trait progress" curves? x julian date
-----------
Mon 20may13
*- merging germplasm lines that have data
C- graphic of heatmapped plots; easy in R using rainbow(), heat.colors()
V- non-TCAP registered users; check Sandbox defaults
- allow saving multiple named Sets of selections, "projects"?
- new CSR instrument, ASD HandHeld 2, Kyle Shroyer
- API for T3? listing in data.gov?
- CSR smoothing for index download vs. graph
- publication in Crop Science
- loading 90K genotyping takes ca. 18 hr.
- 18 CSR datasets from Katherine Frels
- Tom: multi-trait indices, estimated breeding value; useable with Select
by Phenotype
-----------
Mon 13may13
- THT security incident
* - Notify all users that their password is known? Y
- Disallow 'publicuser' from reading table 'users'?
- Use sha2 instead of md5?
- Trials with non-TCAP data to be excluded when loading CSR or plot-level
results. Use fieldbook to list only plots that should be included?
No, don't make us convince you we're trustworthy.
- loading big genotype datasets: autocommit, allele_cache rebuild
- Eduard's 400KGBS SynOpDH is PstI reduced-representation, not exome-capture.
* Jesse/Eduard conference on Tue after Mem Day, or a later Monday re A/B
- Line HAHN__S, single-quotes
- 4/5 of the 90K panels are loaded.
- Spring AM Panel line not recognized?
- import page for plot level data
- function filelink() for showing template file datestamps
- SW_AM_Panel_2012_Davis_Dry results from Marco Maccaferri
-----------
Mon 6may13
- Mary Guttieri vs. GWAS
- long compute runs: 'Check Results' button, email notification
- displaying the line-filtration results first
- downloading the PCA results
- Sign in first to avoid losing selections and get email.
- negative values for kinship?
- HWW association panel 90K-SNP genotypes loaded
- wheat consensus GBS/DArT/SSR map from Eduard
*- handling gene-capture GBS markers, 400K
- User Group May 13? Plot-level data demo
- problem loading genotype data; "--" for missing?
- GAPIT, Alex Lipka
*- DAP -> Julian, whoops
C- Wizard bugs (barley programs with no trials, data-only programs)
-----------
Mon 29apr13
- plot-level data requirements doc from Clay
- loading 90K data. slow.
- linking barley markers to genome sequence, Tim Close
- Gary and Jorge pushing phenotype data submission
- slow Quick Search on tcap machine
- Brassica Toolbox planning May 6-7: Mike Gore, David Grant...
*- multiple Breeding Programs per LineSubmission file
-----------
Mon 22apr13
- defining "raw" phenotype data, vs. groundhog damage
*- data validation: moving average, repeatability, Trait1 x Trait2 scatter,..
plot dimensions in Trial annotation?
validating mean data: heritability, Trait1 x Trait2, PCA of all traits
- fieldbook apps, Documents To Go
C- plot-level data
- T3 is now iOS compatible!
- CSR Index page
- filtering lines by genotype data
C- slow Quick Search on tcap machine
- PAG slides with fraudulent "Uploaded to T3" claims
- lines with more than two parents
- tooltip-labeled, clickable points in R graphs
- heading date DAP -> Julian project
- "Create Fieldbook". R package for experimental design.
Alpha Lattice, augmented
- R prcomp() uses svd()
- Genotype trial source files
-----------
Mon 15apr13
- Select Lines by Genotype Experiment,
http://malt.pw.usda.gov/t3/wheatplus/downloads/select_genotype.php
**** BOPA's 2010 no lines; sandbox only
- heading date DAP -> Julian project
missing means files from old THT trials
Lat/Long missing
* JulianDays = DAP + PlantingDate + 0.25 * LeapDay
- NAKARA for local population structure in a chromosome region
http://www.linkedin.com/pub/mark-koni-wright/26/491/23
- Breeders Database deliverables for July 1
- Cross Designer: query for the N lines with maximum marker allele diversity
in a set of lines
- User Group meeting
- genotype datasets due
- survey results as action items
- Line passport info for Eduard's 9K wheat allele data. Minimum requirements?
- 'Sneak Preview' of the Breeder's DB at the NAPB meeting in early June?
-----------
Mon 8apr13
- chat with General Mills this morning
- Line Submission form:
Allow multiple Breeding Programs
- "Select Lines by Genotype" page.
1. It now does not use previous line selection. A new selection is created.
2. changed label from "Trials" to "Experiments"
3. does not save "Experiment" selection
to session only lines.
- GBS: review plan for loading markers and genotype data
- Consult with Jesse re A/B convention.
- Jesse's; use sequenced strand nucleotide, alphabetical rule
- Exome GBS use Illumina rule. Ignore end-of fragment SNPs too close
for Illumina. Must find out where the breakpoints are.
- imputing missing markers
- categorical and float
- mean value in the database. mean value for current set of lines
- map-based imputation not available for us yet.
- non-map-based: simple linear model, random forest (Jessica)
- automated validation: propose some things to user group
-----------
Tue 2apr13
- private data from Luther Talbert; not from TCAP?
- describing the units (bins) for the wheat AntMap
- Wizard "Select Genotype" link fixed. (What is this for?)
Default "All" for Genotyping Experiments?
- at http://malt.pw.usda.gov/t3/bd :
- new LineSubmissionForm_Wheat.xls
- yellow box revamped
- supports generalized line properties
- new, verbless "Curate" menu
- possible collaboration with General Mills (Eric Jackson)
Preliminary results from survey:
Big Tasks:
1. GBS; 60% want tags; 40% think SNPs sufficient
2. Plot-level data
3. Analysis of CSR
4. Private data
"Small" Tasks:
1. Automated validation
2. Imputing missing marker points
3 = 4. Phenotype information on cluster = Links between markers and
other genomic resources
-----------
Mon 25mar13
- User Group call at 3pm EDT, http://www.surveymonkey.com/s/NF3KCZT
- store imputed allele data
- filtering allele data by both lines and markers for faster analysis
- lines first or m
- renaming synopGBS markers
- SAB: plot-level data to "allow users to filter data sets by
specific data points for quality control"
- script to find matching GBS tags based on tag sequence
- Jesse's 300K mapped wheat GBS tags
- Where to publish next T3 article, Molecular Breeding?
- Vic to talk to NAPB in Tampa in June, with GCP and iPlant
- Scott Haley private data
****- change heading dates
-----------
Mon 18mar13
C*- marker filtering and marker types for Download, #5761
http://malt.pw.usda.gov/cbirkett/t3/barley/downloads/downloads.php
Filter lines too.
*- need answering: Ibrahim and Mary re DArTs and GBS SNPs
- wheat GBS bin map renamed BinMap; Antmap in progress
- heading dates being converted to Julian
- VeraCode 384-SNP data loaded
- What's New length overflow; excess to a Whatsnew page?
- joining oat CORE pre-proposal
- ViroBLAST interface spiffed up, available at
http://wheat.pw.usda.gov/GG2/WheatTranscriptome/viroblast
- old business
- SNP annotation from Peter Morrell
* - generalized line properties
- User Group call next Monday:
1. Analysis, histogram display
2. Download, allele frequency calculation is now optional
3. Clustering, selecting allowed marker types should be functioning by
next week.
- Gary M: maximize genetic diversity in a set of lines
- SurveyMonkey:
- CSR analysis online
- plot-level data
- connecting to barley genome
sequence
- GBS tags: what to store? raw reads, 20GB? tags-by-taxa, +depth?
- imputation
- marker panels (Yes)
- automated curation/validation of data: novel haplotypes,
phenotype outliers
-----------
Mon 11mar13
- DArT marker genotypes, present/absent
- GBS SNP tags without marker names (Ibrahim)
- GBS "raw vs. imputed SNP calls" files (Guttieri):
Store one raw and one imputed.
- lots of phenotype data from Ibrahim, Guttieri, Grogan...
- Cluster by Genotype, 89 CAPCore lines, hclust: query 6 sec, analysis 98 sec
* missing rectangles, how many markers are in common between two lines?
how many marker-SETs are in common between two lines?
marker-sets: GBS, DArT, OPA. For TASSEL/R/etc. too.
- killing old R processes on tcap
- letter of support for Plant Ontology
- oat CORE meeting last week
- Jesse's wheat GBS map clarified by Jesse
- synonymizing the two synopGBS marker-name sets
- hundreds of thousands of mapped sequence tags with no SNP
- Nick Tinker's POOL pedigree display pastes into Excel cells
- heading date traits
- Breeders Datafarm vs. T3
- SNP annotation from Peter Morrell
-----------
Mon 4mar13
- Eduard's 2000 wheats x 9K wSNPs
- generalized line properties now selectable:
http://malt.pw.usda.gov/t3/wheatplus/pedigree/line_properties.php
- simplified version of line import template? No
- minimum information for a line?
* Don't allow uploading same line with different Filial
*- SNP annotation from Peter Morrell
- Jesse's wheat GBS map
- fixed: rare bug in phenotype data download, some trait/trials omitted
- CSR Data upload is slow.
- Where to publish an article about T3?
- oat meeting in Ottawa this week
- leftovers from last week
- CSR from multiple reads per plot during season
**** - protection for private non-TCAP data (Scott Haley)
what's already covered? genotype? phenotype? Line report -> Show Pheno
- descriptions for curator's line panels
- remove barley UCR map?
*- properties loaded page , About T3 -> Genetic Characters page
*- Replace "Properties" with "Genetic Characters" everywhere
*- tell Vic re new templates, in advance
- 90K data x 2500 lines from Shiaoman in April
-----------
Mon 25feb13
- T3 User Group call at 3pm
- remove barley UCR map?
- descriptions for curator's line panels
- Are we going to distinguish BLUP's from means?
- CSR from multiple reads per plot during season
- protection for private non-TCAP data, see Scott Haley
- R web apps using Shiny
- showing trials that have CSR data
- generalized line properties now displayable,
http://malt.pw.usda.gov/t3/wheatplus/view.php?table=line_records&name=CALEDONIA
- Jesse's wheat GBS map
- SNP annotations coming from Peter Morrell
C- template using Excel Date format: CSR Experiment Annotation
****- filelink() -> Clay
- CSR Data upload is slow.
-----------
Tue 19feb13
- CSR index calculation,
http://malt.pw.usda.gov/t3/wheat/curator_data/input_csr_router.php
C* ? code injection?
- CSR and other raw files for the Sandboxes
- store CSR raw data in MySQL?
- new ways to break the phenotype data import, from Paul Murphy
- generalized line properties now loadable,
http://malt.pw.usda.gov/t3/wheatplus/curator_data/input_trait_router.php
- genotype data overdue?
- error in UCR map, 2_1184?
-----------
Mon 11feb13
- Ae. tauschii map for wheat loaded
* - need GBrowse
* - GrainGenes
- fieldbook import fixed; link from display_phenotype.php
- phenotype data from Nancy Blake
*- general Edit Anything: security, table users; sanitize input
- climate data; proposal due Friday
- insect traits in Breeders DB
- inconsistent Unit Info
- first CSR data loaded!
http://triticeaetoolbox.org/barley/display_phenotype.php?trial_code=CAPWUE_2012_HighN_Bozeman
C*- revise CSR Annotation template
- vertical layout for annotation report tables
- growth stage: show text version, link to PO
- TCAP definition of a WUE experiment
- new Trait template
- news summary for TCAP newsletter
- GWAS example
-----------
Mon 4feb13
*- POPA annotations from Peter Morrell
V*- wheat GBS map from Poland, PLoSONE 2012
- SNP position in Tag numbered from where? 5 - 63
- generalized schema for line properties in t3/wheatplus
- seed stocks for genotyping experiments? Line Translation file?
*- summary stats and histogram for a phenotype trial (Click on each trait.)
- JavaScript InfoVis Toolkit graphics library
- create CSR indices
- average intensities over specified interval
*- general Edit Anything: mapset names, Trait Categories
- Big Data webinar tomorrow
-----------
Tue 29jan13
- getting the wheat Synthetic x Opata maps from
http://www.plosone.org/article/info%3Adoi%2F10.1371%2Fjournal.pone.0032253
* sort out synopGBS marker correspondences
- updating the phenotype dataset delivery page
- linking out from markers to barley genome sequence
- linking from Manhattan plot dots to corresponding Marker reports
Use a table? R labeling? (Aurelio)
* X3D?
* update R on malt
- new Select / Genetic Map page
- GWAS principal component plot uses Selected Map, and allows
specifying fixed effects
* - rename maps?
**** - Google Analytics logging installed: link to Admin menu
- checking genotype data for different lines > 99% identical
* - conflicts by line, with number for each
- Data Submission page now shows datestamps for all templates.
- Breeders Database
- Gina has genotyping data on the same lines
- call with Paul Murphy Fri 11:30 EST
- okay to invite them to our User Group calls?
- fieldbook schema, loading improved
*- seed stocks for genotyping experiments? Line Translation file?
- subsetting the Allele Data Conflicts query?
- priorities for 2013
!!!* - histogram when loading phenotype trial
-----------
Mon 7jan13
- Content Status now shows what detailed reports are available.
- Sandboxes now update maps too.
- redirecting the out-of-date http://wheat.pw.usda.gov/t3
- PAG presentations for TCAP, workshop, poster
- CSR data status
- Spectrometer system
- matching trial name
- what results do users want?
-----------
Wed 2jan13
- new Data Submission page and tutorials
- new GS page,
http://triticeaetoolbox.org/barley/downloads/download_gs.js
- PAG poster questions from Vic: GS, download for R
- CSR output from Nebraska USB2000, CALMIT Data Acquisition Program,
csr_20120604_1_651_001_0142.upwelling
- Jean-Luc's PAG TCAP report
- redirecting the out-of-date http://wheat.pw.usda.gov/t3
****http://malt.pw.usda.gov/t3/sandbox/barley/maps.php Hutton missing
****empty barley map
****http://malt.pw.usda.gov/t3/sandbox/barley/curator_data/examples/VC_FH2011_2Ddata.txt missing
****missing
report of datapoints per trait/year